Review




Structured Review

Evident Corporation fluoview 500 confocal laser scanning microscope
Fluoview 500 Confocal Laser Scanning Microscope, supplied by Evident Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fluoview+500+confocal+microscope/FV3000+Confocal+Laser+Scanning+Microscope/10__4103_slash_nrr__nrr___d___23___01338-80-5-11
Average 99 stars, based on 1 article reviews
fluoview 500 confocal laser scanning microscope - by Bioz Stars, 2026-09
99/100 stars

Images

Related Articles

Imaging:

Article Title: FcRn Overexpression in Transgenic Mice Results in Augmented APC Activity and Robust Immune Response with Increased Diversity of Induced Antibodies
Article Snippet: .. For confocal imaging we used an Olympus Fluoview 500 confocal microscope (Hamburg Germany) equipped with four optical channels and a 60× (numerical aperture of 1.45) oil immersion objective. ..

Microscopy:

Article Title: FcRn Overexpression in Transgenic Mice Results in Augmented APC Activity and Robust Immune Response with Increased Diversity of Induced Antibodies
Article Snippet: .. For confocal imaging we used an Olympus Fluoview 500 confocal microscope (Hamburg Germany) equipped with four optical channels and a 60× (numerical aperture of 1.45) oil immersion objective. ..

Article Title: Single-cell RNA-seq uncovers novel metabolic functions of Schwann cells beyond myelination.
Article Snippet: Footpads were fixed in Zamboni Fixative (cat# 1459A, Newcomer Supply; PUR 2021), rinsed in 30% sucrose solution in 0.1 M sodium phosphate buffer, cryoembedded, sectioned (30 μm), and stained for pan- axonal marker PGP9.5 (1:2000; Proteintech, RRID:AB_2210497). .. Images were taken using an Olympus FluoView 500 confocal microscope with a 20 × 1.2 objective at a resolution of 1024 × 1024 pixels. .. Fiber counts and lengths from 3 stacked images/ mouse were quantified using MetaMorph (v.7.7.0.8, Molecular Devices) and presented as the number of fibers per millimeter of epidermis.

Article Title: Heterogeneous Sensory Innervation and Extensive Intrabulbar Connections of Olfactory Necklace Glomeruli
Article Snippet: .. Individual confocal z-stack optical sections were taken at 1 μm spacing using an Olympus Fluoview 500 confocal microscope. ..

Article Title: Afferent activity to necklace glomeruli is dependent on external stimuli
Article Snippet: .. Sections were visualized with an Olympus Fluoview 500 confocal microscope. .. Confocal images were processed using Olympus Fluoview v5.0 software.

Article Title: Identifying mRNA, MicroRNA and Protein Profiles of Melanoma Exosomes
Article Snippet: .. Pictures were taken on an Olympus Fluoview 500 confocal microscope. ..

Article Title: Caveolae-Dependent and -Independent Uptake of Albumin in Cultured Rodent Pulmonary Endothelial Cells
Article Snippet: Cells were fixed with 2% paraformaldehyde and stained with DAPI (Life Technologies, Carlsbad, CA, USA) to reveal cell nuclei and then slides were peeled off and sealed with Fluoromount-G (Southern Biotechnology Associates, Birmingham, AL, USA) under coverslips. .. Images were taken with Nikon Eclipse 80i fluorescence microscope (Nikon, Melville, NY, USA) and a Fluoview 500 confocal Microscope (Olympus, Center Valley, PA, USA). .. After incubating with Alexa488-BSA and washing with HBSS, cells were fixed with 2% paraformaldehyde for 15 min at room temperature and then permeabilized with 0.1% Triton X-100 (Sigma-Aldrich, St Louis, MO, USA) for 15 min.

Article Title: Caveolae-Dependent and -Independent Uptake of Albumin in Cultured Rodent Pulmonary Endothelial Cells
Article Snippet: Cell nuclei were stained with DAPI (Life Technologies, Carlsbad, CA, USA) and coverslips were sealed on slides. .. Images were taken with Nikon Eclipse 80i fluorescence microscope and an Olympus Fluoview 500 confocal Microscope. .. Small interfering RNA (siRNA) was designed against the coding sequence of cav-1 cDNA ( AAGAGCTTCCTGATTGAGATT ) and both siRNA and sham siRNA (with scrambled sequence) were purchased from Dharmacon (Chicago, IL, USA).

Article Title: TBL2 Is a Novel PERK-Binding Protein that Modulates Stress-Signaling and Cell Survival during Endoplasmic Reticulum Stress
Article Snippet: .. Fluorescence images were obtained with an Olympus Fluoview 500 confocal microscope using 488-nm laser excitation for Alexa-488 or 543-nm for Alexa-568. ..

Fluorescence:

Article Title: Caveolae-Dependent and -Independent Uptake of Albumin in Cultured Rodent Pulmonary Endothelial Cells
Article Snippet: Cells were fixed with 2% paraformaldehyde and stained with DAPI (Life Technologies, Carlsbad, CA, USA) to reveal cell nuclei and then slides were peeled off and sealed with Fluoromount-G (Southern Biotechnology Associates, Birmingham, AL, USA) under coverslips. .. Images were taken with Nikon Eclipse 80i fluorescence microscope (Nikon, Melville, NY, USA) and a Fluoview 500 confocal Microscope (Olympus, Center Valley, PA, USA). .. After incubating with Alexa488-BSA and washing with HBSS, cells were fixed with 2% paraformaldehyde for 15 min at room temperature and then permeabilized with 0.1% Triton X-100 (Sigma-Aldrich, St Louis, MO, USA) for 15 min.

Article Title: Caveolae-Dependent and -Independent Uptake of Albumin in Cultured Rodent Pulmonary Endothelial Cells
Article Snippet: Cell nuclei were stained with DAPI (Life Technologies, Carlsbad, CA, USA) and coverslips were sealed on slides. .. Images were taken with Nikon Eclipse 80i fluorescence microscope and an Olympus Fluoview 500 confocal Microscope. .. Small interfering RNA (siRNA) was designed against the coding sequence of cav-1 cDNA ( AAGAGCTTCCTGATTGAGATT ) and both siRNA and sham siRNA (with scrambled sequence) were purchased from Dharmacon (Chicago, IL, USA).

Article Title: TBL2 Is a Novel PERK-Binding Protein that Modulates Stress-Signaling and Cell Survival during Endoplasmic Reticulum Stress
Article Snippet: .. Fluorescence images were obtained with an Olympus Fluoview 500 confocal microscope using 488-nm laser excitation for Alexa-488 or 543-nm for Alexa-568. ..



Similar Products

99
Olympus fluoview 500 confocal laser scanning microscope
Fluoview 500 Confocal Laser Scanning Microscope, supplied by Olympus, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fluoview+500+confocal+microscope/FV3000+Confocal+Laser+Scanning+Microscope/pmc11624882-74-5-11
Average 99 stars, based on 1 article reviews
fluoview 500 confocal laser scanning microscope - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
Evident Corporation fluoview 500 confocal laser scanning microscope
Fluoview 500 Confocal Laser Scanning Microscope, supplied by Evident Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fluoview+500+confocal+microscope/FV3000+Confocal+Laser+Scanning+Microscope/10__4103_slash_nrr__nrr___d___23___01338-80-5-11
Average 99 stars, based on 1 article reviews
fluoview 500 confocal laser scanning microscope - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

90
Evident Corporation fluoview-500 laser scanning confocal microscope
Fluoview 500 Laser Scanning Confocal Microscope, supplied by Evident Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fluoview+500+confocal+microscope/bx51+microscope/pm37485877-258-6-5
Average 90 stars, based on 1 article reviews
fluoview-500 laser scanning confocal microscope - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Evident Corporation fluoview 500 confocal microscope
Fluoview 500 Confocal Microscope, supplied by Evident Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fluoview+500+confocal+microscope/bx51+microscope/pm37328915-82-6-5
Average 90 stars, based on 1 article reviews
fluoview 500 confocal microscope - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Evident Corporation fluoview 500 laser scanning confocal microscope
Fluoview 500 Laser Scanning Confocal Microscope, supplied by Evident Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/fluoview+500+confocal+microscope/bx51+microscope/pm36683433-76-7-6
Average 90 stars, based on 1 article reviews
fluoview 500 laser scanning confocal microscope - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results